Human Variation: The Effects Of Solar Radiation

   Solar radiation affects all of Humanity at different levels. The biggest factor in how people are affected by solar radiation is their location. The location of a group of people will affect the pigment of their skin due to the amount and type of melanin they have which is controlled by at least 6 genes. Melanin is produced by cells called melanocytes to detect and produce against ultraviolet rays. Ultra violet rays can be damaging to people in different ways ranging from sunburn to skin cancer.
   Humans have adapted to fight off the damaging effects of solar radiation in many different ways. Developmental adaptations were acquired through natural selection according to the location of a certain group of people. People who live in areas closer to the equator are more exposed to solar radiation and have a darker pigment with more melanin and produce a type called eumelanin, which helps protect them from damaging UV rays. While people in northern parts of the world with less direct exposure to solar radiation produce less melanin in a form called pheomelanin. These people such as European Americans are at ten times the risk of malignant skin cancers than darker pigmented skin people such as African Americans in the United States.
   Some people may have a higher exposure of solar radiation according to the time of year. During the spring and summer months people may be more exposed to solar radiation due to warm weather and longer days. As a short-term adaptation these people may tan and have a darker pigment than they do during the winter and fall seasons due to participating in more outdoor activities and wearing less protective clothing. When these warm seasons disappear or if they are on vacation in a location where solar radiation is greater then return home, their pigmentation and melanin levels will return to normal.
  A person who grew up and was raised in a region where solar radiation is high may have a darker pigmentation and higher melanin levels to help protect them from the danger of radiation exposure. If that individual moves to an area with much lower levels of solar radiation, in time their skin pigmentation will become lighter and their melanin levels may change. They may also become more prone to sun burn when visiting the place they have grown up in after years of adapting to less solar radiation as a kind of facultative adaptation.


Locals in Hawaii (personal pic)

Tourists in Hawaii

    Some cultural adaptations to help supplement the lack of melanin and to prevent damage from solar radiation are the use of items that offer protection against UV rays. Sun screens that contain SPFs offer protection against burns and when exposure to solar radiation is higher and more frequent, the potential for skin cancers. Items like sunglasses and sun hats also help protect against the radiation of the Sun's UV rays. When vacationing in a tropical climate or at your next trip to the beach, take time to notice whether individuals with lighter skin pigments are enlisting the help of items such as hats, and umbrellas more than the individuals who are local to the area and have darker pigments.
   Studying the effects of the adaptation of skin pigment and melanin due to solar radiation can be very useful scientifically and socially. It also allows us to understand why some people are more susceptible to the dangers of solar radiation to help develop ways to lessen the exposure to the threat. It also allows us to make advances in medicine and educate people on the damaging effects of solar radiation. Socially, it breaks down the barrier of misconceptions and the social stigma of race associated with skin color.
   Understanding the variation of adaptation in skin color allows us to see from a scientific standpoint why different people of different regions have the skin pigment that they do. It also allows us to see that color is no more that natures way of protecting people from the elements and not at all a reason for division of class, economic status or opportunity. Rather, it is nature's way of evening things out a bit by giving better survival tools to people in regions who need it most. In a way, skin color naturally makes us more equal rather than racially unequal.

The Piltdown Files: Science vs. Dawson

    In Southeast England, in a rural town called Sussex was an amazing discovery in the early 1900s. A laborer was digging near the village of Piltdown at the Barkham Manor and unearthed what was going to be known as a great scientific and historical discovery. The remains of a fossilized skull was given to an amateur archeologist by the name of Charles Dawson.
**editors note: the video states that Dawson was digging and found  the remains but in the transcript of the video from the assignment's provided link, the narrator states that it was uncovered by a laborer and handed over to Dawson**
    Dawson claimed that with closer examination of the skull that it was thicker than that of a human and appeared to be primitive. This discovery became an important one as Charles Darwin's theory of evolution had recently been publish just 50 years before. After the publication Charles Darwin's Origin Of Species the first remains of primitive man were discovered in Germany and was named "Neanderthal". Soon after Germany became the birthplace, discoveries were made in France and Spain but no British discoveries were made until the discovery in Piltdown.

     Dawson enlisted the help of a geologist, Sir Arthur Woodward of London's Natural History Museum. An apelike jawbone with humanlike teeth was discovered while he accompanied Dawson in digging at the site. There was still some speculation of it's origin due to a missing piece which would connect the jawbone to the skull and a canine that would help determine if this fossil was more human or apelike. A year later, the missing canine was uncovered and then in 1917 another skull and tooth of a second Piltdown Man.
     For over forty years this was an extraordinary breakthrough because until the discovery of the Piltdown Man little was know of man's early ancestors. Scientists were able to observe and build their careers around this miraculous find. But after twenty years more remains of early man have been discovered in other parts of the world and was shown to be much more apelike that Piltdown Man, but was dated to be more recent. Then in 1953, it was discovered to all be a hoax. Dawson was dubbed a phony and the credibility and careers of all scientists who built their work upon the Piltdown Man was at stake. With the scientific community in an uproar and the reputation of London's Natural History Museum at stake, the museum ran more tests that confirmed the allegations. It was a fake. The humanlike teeth were obviously filed down to appear more human like, the jawbone actually belonged to an orangutan and the skull was not as old as it appeared. The pieces were all filed and stained to appear to be the fossils of man's early evolution. Till this day there have been many suspects as to who was an accomplice in this crime and the mystery still remains.

    Science is an amazing field. It helps us understand the world around us. There are many great scientist that have made valuable contributions to how we understand our world. These men such as Galileo, Copernicus and Einstein will be always be remembered and valued for their work and discoveries. But not all scientist will make major break through discoveries. Some will never be listed in our history books, and for some that may be very frustrating. People generally want to be recognized for their work and efforts. No one wants to be stuck in a job where they feel unvalued but others take it a step further. People such as Charles Dawson crave the praise and fame so much that they are willing to risk the credibility of their respective fields and others who work hard to maintain their integrity. Such selfish acts also set real science back because what scientists know to be true isn't and all of their work was in vain and must start again with a clean slate at no fault of their own.

    Testing of authenticity and hypotheses are vital in science. Everything must be tested thoroughly several times and looked at from an objective perspective. In 1949 with new technology scientists were able to more accurately date the fossils using fluorine tests. These tests confirmed the speculation of the falsehood of Piltdown Man. More tests were conducted and the fossils were more closely examined under a microscope revealing the filing of the teeth and the orangutan origins of the jawbone making the entire discovery a sham.

  Although human error or sometimes lack of integrity can cause an enormous setback in scientific studies I don't think it is possible to take the human factor out of science. Without the human factor we wont be able to look at things from different angles. Computers and machinery do not have a curiosity about the way things work. The human factor is essential in the scientific method. It causes curiosities that lead to hypotheses. If an experiment or study is done correctly and for it to be sound science, all hypotheses and discoveries will be questioned by other scientists which is also part of the human factor which then should lead to vigorous testing to solidify or disprove the claims.

    It is very important in science and in life that as much as we want something to be true, regardless of how great it may seem, we must always approach it with at least a bit if skepticism before leaping in full heartedly. And if that thing does seem to be a bit sketchy we should never be afraid to speak up and vocalized our concerns. Things should always be tested before for taken for face value because the human factor is in everyone's DNA and sometimes we even lead ourselves astray so we can't expect less from anyone else.
   

Comparitive Primate

         

Lemurs

 



  Lemurs are a primate in the sub-order Stepsirhini. They live on the island of Madagascar and have survived because of their isolation. All Lemurs are at least partly arboreal and spend little time on the ground. They move through trees by running along branches and leaping. 

  

      Lemurs have a dental formula of 2-1-3-3. 2 incisors, 1 canine, 3 premolars, 3 molars. They have a dental comb or of lower incisors and canines. Their upper incisors are sererated from each other by wide spaces an the lower premolars are canine-like. The modified dental comb of the Lemur is ideal for the tree, fruit and insect diet of these arboreal animals and also serve as a grooming tool. These dental combs are used for combing the fur. There is indirect evidence that condylarths used this structure in the same way, millions of years before tooth combs evolved in prosimians. Grooming is an important bonding ritual in their groups.

Spider Monkey
   Spider Monkeys live in the rainforests of Central and South America in the highest part of the rainforest canopies. These Platyrrhines live in band of up to thirty-five but forage in smaller sub-groups to lessen the competition for food. Their diets consist primarily of, but is not limited to, fruit, seeds and plants. These primates are highly hunted by humans and predator animal species.
    
Like all New World Monkeys, they have a dental formula of 2-1-3-3. 2 incisors, 1 canine, 3 premolars and 3 molars. They have large incisors that are adapted to deal with a minimally resistant pulp of a choice fruit, and small molars with rounded cusps. Which is important for these arboreal primates

 

 

 

Baboon

    Baboons are indigenous to Africa and Arabia. These Old World Monkeys prefer the Savannah and other semi-arid places. Baboons sometimes climb trees but spend most of their time on the ground grazing and foraging. They are opportunistic eaters and have a highly various diet ranging from fruit and plants to carnivorous meals such as small rodents or larger animals like antelope or sheep.
  
 Baboons have heavily rigid skulls and the rostrum is rather long. The Dental formula of the Baboon is 2-1-2-3. 2 incisors, 1 canine, 2 premolars, and 3 molars.  The medial incisors are broad and spoon shaped, upper canines are usually large and separated from incisors by a small diastema. The first lower premolar is enlarged and its edge shears against the sharp posterior edge of upper canine. On the lower molars, a hypoconulid is present. Long Canines on a male Baboons are adaptations for male-male competition, usually for a female. Their teeth also allow them to chew food as efficiently as a Zebra.

 Gibbon

     Gibbons are found in the rainforests of Southeast, South and East Asia. They are small bi-pedal, arboreal apes. They forage the upper canopies of the rainforest for leaves, fruit, insects and birds. Their habitat is declining rapidly leaving them to be captured and sold as pets or killed.
   
   These endangered tree dwellers have a  dentition pattern of  2, 1, 2, 3. 2 incisors, 1 canine, 2 premolars, and 3 molars. Their short rostra and teeth resemble those of great apes. Their molars are bunodont and lack lophs. The upper molars usually have a cingulum, which is sometimes large. The canines are prominent but not sexually dimorphic.
   

   

Chimpanzee

   Our closest living relatives live in the African rain forests, woodlands and grasslands. They live in communites of several dozen. Chimpanzees do most of their eating and sleeping in trees which they can move quite efficiently through by swinging when they aren't knuckle walking on the ground. They have a various diet but generally feed on fruit and plants.

            They have a dental formula of 2-1-2-3. 2 incisors, 1 canine, 2 premolars and 3 molars. Anthropologists have found a link between the the dentition of the Chimpanzee and their diet. Their sharp blades or their thin enamel allows them to shred leaves which is their primary diet while most of their eating is done in trees.

 

Homologies and Analogies

 

Few animals may seem to be as far apart on the spectrum when it comes to similarities as a whale and a bird. Birds fly through the sky with the help of their feather covered wings and flippers make it possible for whales to maneuver through the ocean. But the wings of a bird and flippers on whales are much more similar than you may think. In fact, both tetrapod limbs are a homologous trait that they inherited from their common tetrapod ancestor. This ancestor, the first tetrapod, is believed by scientists to have roamed the Earth 350 million years ago and had limbs with one humerus attached to the radius and ulna.







Unlike the obvious lack of similarities between whales and birds there are some animals that look strikingly similar but are very different such as the Northern Flying Squirrel and the Sugar Glider. These two animals live in separate parts of the world. The Northern Flying Squirrel lives in North America and Sugar Gliders are found in Australia but they share analogous structures. They are both nocturnal and have big eyes to assist them in seeing at night and a thin piece of skin that stretches between their arms and legs to help them glide when leaping from high places. Though these very distant relatives look so much alike the are quite different. The Sugar Glider is a marsupial mammal and give birth to their young very early and provide most of their nourishment in their pouch as their baby develops. Northern Flying Squirrels are placental mammals that spend a much greater deal of time developing in their mother's body being nourished by their mother's placenta. If we go far back enough, we will see that these two animal so in fact share a rat like common ancestor which is the Mammalia.      

               

Week 2: Protein Synthesis

AGTATACCAAGGGAACGTCAGCCAAGGCTTGAATCAAGGACTTATCGCAT

Historical Influences On Charles Darwin

      Thomas Malthus was a social economist whose assertions of the population was the spark that ignited Darwin's theory of natural selection.  Malthus believed that if people did not control the number of children they had it would eventually lead to the demise of mankind.
      When Darwin was coming back from his voyage trying to put together the origins of new species he had heard Malthus' explanation that if it weren't for disease and famine, increasingly crowded cities would face over population. This lead Darwin to ponder the struggle for survival in the wild. He came to the conclusion that in the wild and human population alike, animals breed beyond there means. With limited resources the strong would survive and the weak would cease to exist.
      Darwin concluded that some variations of species would be better equipped to thrive and produce offspring than others. Eventually that species will multiply and be the only variation which is ideally adapted to it's environment. This theory is now known as his theory of natural selection.
      Though Thomas Malthus did not formally make any scientific contributions, Darwin's theory of natural selection can be observed essentially from an economical and social standpoint through Malthus's observations. It is especially helpful in the explanation of Darwin's work since natural selection cannot be formally observed first hand
(http://www.pbs.org/wgbh/evolution/library/02/5/l_025_01.html)
     Malthus's work is an example of limited resources playing a main role in the theory of natural selection. With a limited number of resources whether from an economical standpoint or in the wild, only those best suited to access of those resources can survive.
      It is possible that Darwin could have eventually come up with his theory later on without the help of stumbling upon Malthus's work but he indeed helped Darwin solve a major issue that he was having with his hypothesis if evolving species.
      The attitude of the church definitely hindered Darwin from wanting to publish his theory of evolution because he knew that it went against everything that everyone knew to be true. he knew that his theory would challenge the Bible and from examples of other scientists before him like Nicolaus Copernicus and Galileo Galilei, he would face persecution. But unlike his predecessors, his theory has yet to be accepted by the church to be true.